PCR Genotyping Protocol .

Protocol for genotyping of TLR1-deficient mice

For detection of the mutated allele, we use primers "b" and "c". For wild-type allele, "b" and "a".

"a"; 5'-GAT GGT GAC AGT CAG CAG AAC AGT ATC-3'

 specific for the targeted TLR1 gene.

"b"; 5'-AAG GTG ATC TTG TGC CAC CCA ACA GTC-3'

 specific for the TLR1 gene downstream of the targeting construct.

"c"; 5'-ATC GCC TTC TAT CGC CTT CTT GAC GAG-3'

 specific for the neo resistance gene.

At 85ºC, the mixture of "b" and "c", or "b" and "a" is added to PCR reaction solution (total 50 microL). 

Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67ºC, 67ºC for 1 min, 74ºC for 1 min, then 74ºC for 10min prior to cooling to 4ºC. 

The amplified products are both about 1300 base pairs.

 

 

Protocol for genotyping of TLR2-deficient mice

For detection of the mutated allele, we use primers "b" and "c". For wild-type allele, "b" and "a".

"a"; 5'-GTT TAG TGC CTG TAT CCA GTC AGT GCG-3'

 specific for the targeted TLR2 gene.

"b"; 5'-TTG GAT AAG TCT GAT AGC CTT GCC TCC-3'

 specific for the TLR2 gene downstream of the targeting construct.

"c"; 5'-ATC GCC TTC TAT CGC CTT CTT GAC GAG-3'

 specific for the neo resistance gene.

At 85ºC, the mixture of "b" and "c", or "b" and "a" is added to PCR reaction solution (total 50 microL). 

Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67ºC, 67ºC for 1 min, 74ºC for 1 min, then 74ºC for 10min prior to cooling to 4ºC. 

The amplified products are both about 900 base pairs.

 

 

Protocol for genotyping of TLR3-deficient mice

For detection of the mutated allele, we use primers "b" and "c". For wild-type allele, "b" and "a".

"a"; 5'-cca gag cct ggg taa gtt att gtg ctg-3'

 specific for the targeted TLR3 gene.

"b"; 5'-tcc aga caa ttg gca agt tat tcg ccc-3'

 specific for the TLR3 gene upstream of the targeting construct.

"c"; 5'-atc gcc ttc tat cgc ctt ctt gac gag-3'

 specific for the neo resistance gene.

At 85ºC, the mixture of "b" and "c", or "b" and "a" is added to PCR reaction solution (total 50 microL). Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67ºC, 67ºC for 1 min, 74ºC for 1 min, then 74ºC for 10min prior to cooling to 4ºC. 

The amplified products are about both 1000 base pairs.

 

 

Protocol for genotyping of TLR4-deficient mice

For detection of the mutated allele, we use primers "b" and "c". For wild-type allele, "b" and "a".

"a"; 5'-cgt gta aac cag cca ggt ttt gaa ggc-3'

 specific for the targeted TLR4 gene.

"b"; 5'-tgt tgc cct tca gtc aca gag act ctg-3'

 specific for the TLR4 gene upstream of the targeting construct.

"c"; 5'-tgt tgg gtc gtt tgt tcg gat ccg tcg-3'

 specific for the neo resistance gene.

At 85ºC, the mixture of "b" and "c", or "b" and "a" is added to PCR reaction solution (total 50 microL). 

Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67ºC, 67ºC for 1 min, 74ºC for 1 min, then 74ºC for 10min prior to cooling to 4ºC. 

The amplified products are both about 1200 base pairs.

 

 

Protocol for genotyping of TLR5-deficient mice

For detection of the mutated allele, we use primers "extra" and "pgk-rc2". For wild-type allele, "extra" and "wild".

"WILD"; 5'-CTA TCT GGC AAC CAG ATT CAC AGC CTC-3'

 specific for the targeted TLR5 gene.

"EXTRA"; 5'-CAG GTC GTT AAA TAT CCC AGG TGG AAG-3'

 specific for the TLR5 gene upstream of the targeting construct.

"Cpgk-RC2"; 5'-CTA AAG CGC ATG CTC CAG ACT GCC TTG-3'

 specific for the neo resistance gene.

At 85ºC, the mixture of "b" and "c", or "b" and "a" is added to PCR reaction solution (total 50 microL). 

Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67ºC, 67ºC for 1 min, 74ºC for 1 min, then 74ºC for 10min prior to cooling to 4ºC. 

The amplified products are both about 900 base pairs.

 

 

Protocol for genotyping of TLR6-deficient mice

For detection of the mutated allele, we use primers "extra" and "neo". For wild-type allele, "extra" and "wild".

"wild"; 5'-GAA ATG TAA ATG AGC TTG GGG ATG GCG-3'

 specific for the targeted TLR6 gene.

"extra"; 5'-TTA TCA GAA CTC ACC AGA GGT CCA ACC-3'

 specific for the TLR6 gene downstream of the targeting construct.

"neo"; 5'-ATC GCC TTC TAT CGC CTT CTT GAC GAG-3'

 specific for the neo resistance gene.

At 85ºC, the mixture of "extra" and "neo", or "extra" and "wild" is added to PCR reaction solution (total 50 microL). 

Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67ºC, 67ºC for 1 min, 74ºC for 1 min, then 74ºC for 10min prior to cooling to 4ºC. 

The amplified products are both about 300 base pairs.

 

 

Protocol for genotyping of TLR7-deficient mice

For detection of the mutated allele, we use primers "extra" and "neo1500". For wild-type allele, "extra" and "wild-type".

"wild-type"; 5' ACG TGA TTG TGG CGG TCA GAG GAT AAC-3'

specific for the targeted TLR7 gene.

"extra"; 5'-CCA GAT ACA TCG CCT ACC TAC TAG ACC-3'

specific for the TLR7 gene downstream of the targeting construct.

"neo1500"; 5'-ATC GCC TTC TAT CGC CTT CTT GAC GAG-3'

specific for the neo resistance gene.

At 85ºC, the mixture of "extra" and "wild-type", or "extra" and "neo1500" is added to PCR

reaction solution (total 50 micoL). 

Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to

67℃, 67℃ for 1 min, 74℃ for 1 min, then 74℃ for 10min prior to cooling to 4ºC. 

The amplified products are both about 1200 base pairs.

 

 

Protocol for genotyping of TLR8-deficient mice

For detection of the mutated allele, we use primers "extra"and "neo1500". For wild-type allele, "extra"and "wild-type".

"wild-type"; 5'-GTC TGT TGA GAG AGG TTT CCG AAG ACG-3'

specific for the targeted mouse TLR8 gene.

"extra"; 5'-TCC TTA GGA AAA CAT GCC CCC TCA GTC -3'

specific for the mouse TLR8 gene downstream of the targeting construct.

"neo1500"; 5'-ATC GCC TTC TAT CGC CTT CTT GAC GAG-3'

specific for the neo resistance gene.

At 85˚C, the mixture of "extra"and "wild-type", or "extra"and "neo1500"is added to PCR

reaction solution (total 50 micoL). 

Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67˚C, 67˚C for 1 min, 74˚C for 1 min, then 74˚C for 10min prior to cooling to 4˚C. 

The amplified products are both about 1200 base pairs.

 

 

Protocol for genotyping of TLR9-deficient mice

For detection of the mutated allele, we use primers "extra" and "neo1500". For wild-type allele, "extra" and "wild-type".

"wild-type"; 5'-GAA GGT TCT GGG CTC AAT GGT CAT GTG-3'

specific for the targeted TLR9 gene.

"extra"; 5'-GCA ATG GAA AGG ACT GTC CAC TTT GTG-3'

specific for the TLR9 gene downstream of the targeting construct.

"neo1500"; 5'-ATC GCC TTC TAT CGC CTT CTT GAC GAG-3'

specific for the neo resistance gene.

At 85°C, the mixture of "extra" and "wild-type", or "extra" and "neo1500" is added to PCR

reaction solution (total 50 microL). 

Cycling temperature is 35 cycles of 94°C for 30 sec, 30 sec to 67°C,

67°C for 1 min, 74°C for 1 min, then 74°C for 10 min prior to cooling to 4°C. 

The amplified products are both about 1200 base pairs.

 


Protocol for screening of MyD88 knockout mice 

1. Mix the following in a 25 microL reaction

PCR mix

DNA   1 microL

10X Taq Buffer  2.5 microL

2.5 mM dNTP mix  2 microL

Taq polymerase  0.5 microL

DH2O   16.9 microL

MyD88 extra new (20 microM) 1 microL

MyD88 wild new (20 microM) 1 microL

Neo1500 (20 microL)  1 microL 

 

2. PCR conditions:

94°C 2 min X1

94°C 30 sec, 60°C 30 sec, 72°C 60 sec X35

72°C 10 min X1

4°C  forever

 

Primers

MyD88 extra new: 5'- ATCGGCTTAAGTTGTGTGTGTCCGACC-3'

MyD88 wild new: 5'- AAGGCCAAAGGGTGTGGTATTAGGACC -3'

Neo1500: 5'- ATCGCCTTCTATCGCCTTCTTGACGAG -3'

 

Wild-type allele is amplified as about 500 bp product, and mutant allele is amplified as about 300 bp product. 

Wild-type mice: 500 bp product alone

Heterozygote: both 300 bp and 500 bp products

MyD88 KO mice: 300 bp product alone.

 


Protocol for screening of TRIF knockout mice

 1. Mix the following in a 25 microL reaction

PCR mix

DNA   1 microL

10X Taq Buffer  2.5 microL

2.5 mM dNTP mix  2 microL

Taq polymerase  0.5 microL

DH2O   16.9 microL

TRIF extra new (20 microM) 1 microL

TRIF wild new (20 microM) 1 microL

pGKRC2 (20 microL)  1 microL

 

2. PCR conditions:

94°C 2 min X1

94°C 30 sec, 60°C 30 sec, 72°C 60 sec X35

72°C 10 min X1

4°C forever

 

Primers

TRIF extra new: 5'- ACCCTATGAACAGCATGTGTCACAGTG-3'

TRIF wild new: 5'- ACAGTCCCAATCCTTTCCATCAGCCTC -3'

pGKRC2: 5'- CTAAAGCGCATGCTCCAGACTGCCTTG -3'

 

Wild-type allele is amplified as about 500 bp product, and mutant allele is amplified as about 300 bp product. 

Wild-type mice: 500 bp product alone

Heterozygote: both 300 bp and 500 bp products

TRIF KO mice: 300 bp product alone.

 

 

Protocol for genotyping of TIRAP-deficient mice

For detection of the mutated allele, we use primers "b" and "c" and "b" and "a" for wild-type allele. 

"a"; 5'-CATCCTGTGTGGCTGTCTGTGAACCAT-3'

 specific for the targeted TIRAP gene.

"b"; 5'-TGGCCAATGTGTGAGCAAGTTCTGTGC-3'

 specific for the TIRAP gene upstream of the targeting construct.

"c"; 5'-ATC gCC TTC TAT CgC CTT CTT gAC gAg-3'

 specific for the neo resistance gene.

At 85ºC, the mixture of "b" and "c", or "b" and "a" is added to PCR reaction solution (total 50 microL).

Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67ºC, 67ºC for 1 min, 74ºC for 1 min, then 74ºC for 10min prior to cooling to 4ºC. 

The amplified products are both about 900 base pairs 

 

 

Protocol for genotyping of TRAM-deficient mice

For detection of the mutated allele, we use primers "b" and "c". For wild-type allele, "b" and "a".

"a"; 5'- TAGACTTCCCAACACCCATGACAGAGT -3'

 specific for the targeted TRAM gene.

"b"; 5'- GAATGCTCTCCCTCCATATCTGCACAT -3'

 specific for the TRAM gene upstream of the targeting construct.

"c"; 5'- CTAAAGCGCATGCTCCAGACTGCCTTG -3'

 specific for the neo resistance gene.

At 85ºC, the mixture of "b" and "c", or "b" and "a" is added to PCR reaction solution (total 50 microL). 

Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67ºC, 67ºC for 1 min, 74ºC for 1 min, then 74ºC for 10min prior to cooling to 4ºC. 

The amplified products are about 1.2k base pairs for the mutated allele, and about 900 base pairs for the wild-type allele.

 

 

Protocol for genotyping of RIG-I- and MDA5-deficient mice

For detection of the mutated allele, we use primers "b" and "c".  For wild-type allele, "b" and "a".

"a"; RIG-I 5'-gcatcatctctcagctgatgaaggaga -3'

   MDA5 5'-ctcttctaagcgttccctggctagtgt -3'

 specific for the targeted each gene.

"b"; RIG-I 5'-cctactactttaggacccatagtggat-3'

   MDA5 5'-cttgggaaacagctcagtaaaactgcc-3'

specific for each gene downstream of the targeting construct.

"c"; 5'-ctaaagcgcatgctccagactgccttg -3'

 specific for the neo resistance gene.

At 85ºC, the mixture of "b" and "c", or "b" and "a" is added to PCR reaction solution (total 50 microL). 

Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67ºC, 67ºC for 1 min, 74ºC for 1 min, then 74ºC for 10min prior to cooling to 4ºC. 

The amplified products are both about 1000 base pairs.



Protocol for genotyping IPS-1-deficient mice

MuIPS-1-Ex3-Fw: 5'-GCTCTTTCCACTGAGCCATCTGAAGAC -3'

Pgk-rc2-Rv: 5'-CTAAAGCGCATGCTCCAGACTGCCTTG -3'

MuIPS-1-WT-Rv-1:5'-GCCATTGGCCAGCTGTGCCGTCCCTCG -3'

 

PCR composition

DNA       2.0 microL

dH2O       34.8 microL

Buffer (10x)        5.0 microL

dNTP (2.5 mM)        4.0 microL

rTaq (5 u/microL)        0.2 microL

Fw primer (20 microM)    2.0 microL

Rv primer (20 microM)    2.0 microL

 

NOTE: Use MuIPS-1-Ex3-Fw and Pgk-rc2-Rv primer pair for checking mutant

allele and use MuIPS-1-Ex3-Fw and MuIPS-1-WT-Rv-1 primer pair for checking

wild type allele.

 

PCR Condition

1 cycle : 94ºC, 5 min

35 cycles: 94ºC, 30 sec > 65ºC, 1 min > 74ºC, 1 min

1 cycle : 74ºC, 10 min

 

The amplified products are both about 1400 bp.

 

 

Protocol for genotyping of TBK1-deficient mice

For detection of the mutated allele, we use primers "b" and "c". For wild-type allele, "b" and "a".

"a"; 5'- CTAATGGTTGTAGTCAGGGTCTCCTGC -3'

 specific for the targeted TBK1 gene (TBK1 wild).

"b"; 5'- TGCGTTCCTGTCCTGACCGTGATTGTG -3'

 specific for the TBK1 gene downstream of the targeting construct (TBK1 extra).

"c"; 5'- ATCGCCTTCTATCGCCTTCTTGACGAG -3'

 specific for the neo resistance gene (Neo1500).

At 85ºC, the mixture of "b" and "c", or "b" and "a" is added to PCR reaction solution (total 50 microL). 

Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67ºC, 67ºC for 1 min, 74ºC for 1 min, then 74ºC for 10min prior to cooling to 4ºC. 

The amplified products are both about 1200 base pairs.

 

 

Protocol for genotyping of IKKi-deficient mice

For detection of the mutated allele, we use primers "b" and "c". For wild-type allele, "b" and "a".

"a"; 5'- TGCTATTCTTCCTGAGGACCCGAGTGC -3'

 specific for the targeted IKKi gene (IKKi wild).

"b"; 5'- AAGAAACCGGAAATGAGAGCTGCCAGC -3'

 specific for the IKKi gene downstream of the targeting construct (IKKi extra).

"c"; 5'- CTTCCTCTTGCAAAACCACACTGCTCG -3'

 specific for the neo resistance gene (MC1-RC).

At 85ºC, the mixture of "b" and "c", or "b" and "a" is added to PCR reaction solution (total 50 microLl). 

Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67ºC, 67ºC for 1 min, 74ºC for 1 min, then 74ºC for 10min prior to cooling to 4ºC. 

The amplified products are both about 1200 base pairs.

 

 

Protocol for genotyping of IRAK4-deficient mice

For detection of the mutated allele, we use primers "b" and "c". For wild-type allele, "b" and "a".

"a"; 5'- ATTTGACTAAGTCTGGTCTACTCCCCC -3'

 specific for the targeted MyD88 gene (IRAK4 wild).

"b"; 5'- AGTCAAGACCAGAGTTGAACTCGATCC -3'

 specific for the MyD88 gene downstream of the targeting construct (IRAK4 extra).

"c"; 5'- CTAAAGCGCATGCTCCAGACTGCCTTG -3'

 specific for the neo resistance gene (PGKRC2).

At 85ºC, the mixture of "b" and "c", or "b" and "a" is added to PCR reaction solution (total 50 microL). Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67ºC, 67ºC for 1 min, 74ºC for 1 min, then 74ºC for 10min prior to cooling to 4ºC. 

The amplified products are both about 1200 base pairs.


 

Protocol for genotyping of NF-IL6-deficient mice

For detection of the mutated allele, we use primers "a" and "b".  For wild-type allele, "c" and "d".

"a"; 5'-cta ccc gtg ata ttg ctg aag agc ttg-3'

"b"; 5'-ccg cag gaa cat ctt taa ggt gat tac-3'

"c"; 5'-ctt gaa caa gtt ccg cag ggt gct gag-3'

"d"; 5'-gcc aag gcc aag aag acg gtg gac aag-3'

At 85ºC, the mixture of "a" and "b", or "c" and "d" is added to PCR reaction solution (total 50 microL). 

Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67ºC, 67ºC for 1 min, 74ºC for 1 min, then 74ºC for 10min prior to cooling to 4ºC. 

The amplified products are about 250 base pairs in the case of mutated alleles and about 210 base pairs in the case of wild-type alleles.


 

Protocol for genotyping of mPGES1-deficient mice

For detection of the mutated allele, we use primers "b" and "c". For wild-type allele, "b" and "a".

"a"; 5'-CAG TAT TAC AGG AGT GAC CCA GAT GTG-3'

 specific for the targeted mPGES1 gene.

"b"; 5'-GGA AAA CCT CCC GGA CTT GGT TTT CAG-3'

 specific for the mPGES1 gene downstream of the targeting construct.

"c"; 5'-ATC GCC TTC TAT CGC CTT CTT GAC GAG-3'

 specific for the neo resistance gene.

At 85ºC, the mixture of "b" and "c", or "b" and "a" is added to PCR reaction solution (total 50 microL). 

Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67ºC, 67ºC for 1 min, 74ºC for 1 min, then 74ºC for 10min prior to cooling to 4ºC. 

The amplified products are both about 1300 base pairs.

 

 

Protocol for genotyping of floxed-Tak1 mice

For detection of the floxed and wild-type allele, we use primers "FW1" and "FW2". For deleted allele, "Del1" and "Del2".

"FW1"; 5'-GGC TTT CAT TGT GGA GGT AAG CTG AGA-3'

"FW2"; 5'-GGA ACC CGT GGA TAA GTG CAC TTG AAT-3'

"Del1"; 5'-GCA ACT TCG ACA ACT TGC CTT CCT GTG-3'

"Del2"; 5'-GCA CTT GAA TTA GCG GCC GCA AGC TTA TAA CT-3'

The final concentration of each promers is 0.8 microM.

The mixture of "FW1" and "FW2", or "Del1" and "Del2" is added to PCR reaction solution (total 50 microL).

Cycling temperature is 35 cycles of 94ºC for 30 sec, 30 sec to 67ºC, 67ºC for 1 min, 74ºC for 1 min, then

74ºC for 10min prior to cooling to 4ºC.

The lengths of PCR products are, when using primers "FW1" and "FW2", about 280 bp for wild-type and about 320 bp for floxed-Tak1 allele. 

When using primers "Del1" and "Del2", the length is about 1.0 kb for Tak1D allele.



Protocol for genotyping of floxed-Stat3 mutant mice

 We are screening genotype of the floxed-Stat3 mutated allele by PCR amplification using primers "a", "b", and "c".

"a": 5'-CCT GAA GAC CAA GTT CAT CTG TGT GAC-3'

 specific for exon 22 of the Stat3 gene.

"b": 5'-CAC ACA AGC CAT CAA ACT CTG GTC TCC-3'

 specific for exon 23 of the Stat3 gene.

"c": 5'-GAT TTG AGT CAG GGA TCC ATA ACT TCG-3'

 specific for loxP site upstream of the targeting construct.

 PCR is performed using "a" and "b" for the detection of Stat3 flox allele, "b" and "c" for Stat3D allele. 

PCR protocol is as follows: At 85°C, the mixture of "a" and "b" or "b" and "c" (40 pmol each) is added to PCR reaction solution (total 50 microL). 

Cycling temperature is 35 cycles of 94°C for 30 sec, 30sec to 67°C, 67°C for 1min, 74°C for 1min, then 74°C for 10min prior to cooling to 4°C. We use "Perkin Elmer Thermal Cycler 480" for PCR amplification.

The lengths of PCR products are, when using primers "a" and "b", about 200 bp for wild-type and about 350 bp for floxed-Stat3allele. 

When using primers "b" and "c" to detect Stat3D allele, about 70 bp for Stat3D allele and over 3.0 kb for floxed-Stat3 allele.

ページトップへ